GENESIS
Translation from the mutated gene to English


Mutated Genesis gene:

CTCCGCGTACTGCTGTCACCCCGCTGCCCTGCATCC GTTTGTTGCCGTCGCCGTTTGTCATTTGCCCTGCGC TCATGCCCCGCACCTCGCCGCCCGCCCCATTTCCTC ATGCCCCGCACCCGCGCTACTGTCGTCCATTTGCCC TGCGCTCATGCCCCGCACCTCGTTTGCTTGCTCCAT TTGCCTCATGCCCCGCACTGCCGCTCACTGTCGTCC ATTTGCCCTGCGCTCACGCCCTGCGCTCGTCTTACT CCGCCGCCCTGCCGTCGTTCATGCCCCGCCGTCGTT CATGCCCCGCTGTACCGTTTGCCCTGCGCCCACCTG CTACGTTTGTCATGCCCCGCACGCTGCTCGTGCCCC


Translated to Morse code:

.-.. . -/.- .- -./.... .- ...- ./-.. --- -- .. -. .. --- -./--- ...- . .-./- .... ./..-. .. ... ..../---..-./- .... ./... . .-/.- -. -../--- ...- . .-./- .... ./..-. --- .-- .-../--- ..-./- .... ./.- .. .-./.- -. -../--- ...- . .-./. ...- . .-. -.--/.-.. .. ...- .. -. --./- .... .. -. --./- .... .- -/.. --- ...- . .../..- .-/. --- -./- .... ./. .- .-. - ....

Click here to listen to the Morse code translation of the mutated Genesis gene.


Translated back to English:

"LET AAN HAVE DOMINION OVER THE FISH OF THE SEA AND OVER THE FOWL OF THE AIR AND OVER EVERY LIVING THING THAT IOVES UA EON THE EARTH"


Back to Kac Web